A community for electronic music production, modular synthesis, sdiy and more. Log inSign up with Discord, Facebook, Google, Twitter
jp avatar

the human genome. chromosome one (excerpt):
GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGCTGTAGGAGTGA
TGGGGTTCACCTCTAATTCTAAGATGGCTAGATAATGCATCTTTCAGGGTTGTGCTTCTA
TCTAGAAGGTAGAGCTGTGGTCGTTCAATAAAAGTCCTCAAGAGGTTGGTTAATACGCAT
GTTTAATAGTACAGTATGGTGACTATAGTCAACAATAATTTATTGTACATTTTTAAATAG
CTAGAAGAAAAGCATTGGGAAGTTTCCAACATGAAGAAAAGATAAATGGTCAAGGGAATG
GATATCCTAATTACCCTGATTTGATCATTATGCATTATATACATGAATCAAAATATCACA
CATACCTTCAAACTATGTACAAATATTATATACCAATAAAAAATCATCATCATCATCTCC
ATCATCACCACCCTCCTCCTCATCACCACCAGCATCACCACCATCATCACCACCACCATC
ATCACCACCACCACTGCCATCATCATCACCACCACTGTGCCATCATCATCACCACCACTG
TCATTATCACCACCACCATCATCACCAACACCACTGCCATCGTCATCACCACCACTGTCA
TTATCACCACCACCATCACCAACATCACCACCACCATTATCACCACCATCAACACCACCA
CCCCCATCATCATCATCACTACTACCATCATTACCAGCACCACCACCACTATCACCACCA
CCACCACAATCACCATCACCACTATCATCAACATCATCACTACCACCATCACCAACACCA
CCATCATTATCACCACCACCACCATCACCAACATCACCACCATCATCATCACCACCATCA
CCAAGACCATCATCATCACCATCACCACCAACATCACCACCATCACCAACACCACCATCA
CCACCACCACCACCATCATCACCACCACCACCATCATCATCACCACCACCGCCATCATCA
TCGCCACCACCATGACCACCACCATCACAACCATCACCACCATCACAACCACCATCATCA
CTATCGCTATCACCACCATCACCATTACCACCACCATTACTACAACCATGACCATCACCA
CCATCACCACCACCATCACAACGATCACCATCACAGCCACCATCATCACCACCACCACCA
CCACCATCACCATCAAACCATCGGCATTATTATTTTTTTAGAATTTTGTTGGGATTCAGT
ATCTGCCAAGATACCCATTCTTAAAACATGAAAAAGCAGCTGACCCTCCTGTGGCCCCCT
TTTTGGGCAGTCATTGCAGGACCTCATCCCCAAGCAGCAGCTCTGGTGGCATACAGGCAA
CCCACCACCAAGGTAGAGGGTAATTGAGCAGAAAAGCCACTTCCTCCAGCAGTTCCCTGT
CTGAGCTGCTGTCCTTGGACTTGAAGAAGCTTCTGGAACATGCTGGGGAGGAAGGAAGAC
ATTTCACTTATTGAGTGGCCTGATGCAGAACAGAGACCCAGCTGGTTCACTCTAGTTCGG
ACTAAAACTCACCCCTGTCTATAAGCATCAGCCTCGGCAGGATGCATTTCACATTTGTGA
TCTCATTTAACCTCCACAAAGACCCAGAAGGGTTGGTAACATTATCATACCTAGGCCTAC
TATTTTAAAAATCTAACACCCATGCAGCCCGGGCACTGAAGTGGAGGCTGGCCACGGAGA
GAGCCAGGCAATCACTGGCTTTTCCTTAGACAGAGAGCTGGTTCCTAGGAGAAGAAGCTC
CAGGCTGGGGTCCAGGCTATGACCCAACTGTTCAGTTTTGCAACATCCAGCATGGCTGCC
TGATCAGGGGTGCATATGTCAGAGGAGCCTTCAGCTGGGAAGTGCTGACAAATGACCCAG
ACCTGACCTGCCCGATGCCAAGGCCTCCTTTAGTACATCCCATGGAGGACACTTGAGACA
AAGTCACAGCTCAGCCCGTTGATTTCCCATGCTCTGACTGTGCGGTGCAGCAGGACCCCT
AGCAGGCAGCATGTGTTCAAGGCAGCGATATCCAAATGCTATGAATTGCTGTCCTGATGG
TTATTTTCCTGCATACAGTAGAGCTGATCCCTGTACAATGCTGGTCCTAAATCTCACCTT
TGACAGTGCGCTGATGTGCAATGTTTGCTTTTGTTTTATTTGATGGAACATGGCTAATTG
CTAAGAAGGTGACATGCTGCCCACTGACCACCCAATGTTCATTCTCCTCTTCTTCCTTAC
TAACAAAACTGCGGTGGTGGTGGTGAGGAGAGGGAGGGGGTATAACAAATGTGCCAAGCC
AAGAGTTTATATTTGCAAGCCTCTCTTATACCTAGAGTTGATCGTGACACAGCTCTGGCC
AATGATGTGTAAGCAGAAGTTGCTTGATGTGACTTCTGGCAAAGCTCTTAAGGAGAGGAC
TGACCTGTTTCCACATATCTTTTTCCTTTCCGTGTCCTTAGTCCTGGCTGGGATGCAGAT
GAGATGCAAAAGGTGGAGCAGCCATGTTGTCATCAGGCAGTAACAGGTCTGAGGGTAGAA
GCTGCATTCTGATAATACCAGGGAAAAATAATACAAGTAGTCTAGGGCCCAGAGATATCA
CAGATGTCCATTTGAACCCCAAATTACCTGTCTCCAGATTTGCTATCAGGCAAGAAAAGG
AAATCTTTCATTAGTTTAAGCTGTAGTTTACTCCAGTTTTCTATAACTTTCGGCCAGATA
TAACCCTAAATTGACAAAGGGGGCAAGTGCTTAACTGCAAAGCAGTTAAAACTCAAACAC
AGGCCTTCATTTCTTCAGGGTTTTAGTTTTTTCTAGGGAAGAATCTTAACTACTGCTACT
AAAAGTTATAGTAGGCCAGGGATGGTGACTCACGCCTGTAATCTCAGCACTTTGGAAGCC
CAGGCAGGTGGATCACCTGAGGTCAGGAGTTCAAGACCAGCCTGGCCAACGTGGTGAAAC
CCCATCTCTACTAAAAATACAAAAATTAGCCAGGCATGATGGTGCATGCCTGTAGTCACA
CCTACTCAGGAGGCTGAGTCAGGAGAATAGCTTGACCCAGGAGGCAGAGGTGGCAGTGAG
CCAAGATCGCACCACTGCACTCCAGCCTGGGCGACAGAGCAAGACTCTGTCTCAAAAAAA
AAAAAGTCATAATCAAAGAGGAAGACTGAGATAAATGTAGAGTCAAAGGGCTAAACAGAA
ACATAACACATGGGTTTTAAGCTAAGCCTTCACATTATCCCTTATACAATTTTATCTACA
CCGATTTCACCAAAGCTCAAAGTTATATTATTGGCTGAGATTGGCATTGGGATGGAGTGG
TGAAGCTAAGAAATTCGTTATCCCTTTGTTCCAGTGCTGCTGGACTTTTCACTAAGTGAA
GAGGTAAATGCTGAGTCTCCCAGGAGGCTGACTCCTCCTGGCTCTGGGTGTGCATTCTGA
TGAAGGTTCTTTATTGTAGGCACCAACAGAAGGCTCATGAGAGGGCAACATGGATCTCCA
TTTCTGAGCAGATGTTTAAACGCTGAATCAGGTCCAAGGCTTCCCAAATGAACTCAAGGA
GTTTCTTTTTCCCAAGCCATAGAAAGTGGCGATAGCAATCCAGGGTCTGCACTGGGAAGG
AGCACTGCCAGGACACGTCCCTCCCTGCCATTCCCCCACCCTCGCCCAGGAGACGTCCCT
CCCTGCCACCACACAGGACACATCCCTCCTTGCCATCCCACCCCCCTTCCCAGGACACGT
CCCTCCCTGCCATCCCATCCCATTCCCCCACAAGGACACGTCCCTCCCTGTCATCCCACC
CCCCTTCTCAGGACACATCCTTCCCTGCCATCCCACACCCCCCCCAGGACACGTCCCTCC
CTGCCATCCCACGCCTCCCCCCAGGACACATCCCTCCCTGCCATCCCACCCCGCCCCCCA
GGACACACAGGTCCGTGAAATCAGTATAGACACTTGTATCAAGCAAGAAGAAGCATGTTA
CTCAGAAGAACACAATTTTGTTGTTTTGTTTTTGTTTCTGGGTTTTGGTTGTTTTTTTTG
TTTTTTTTTTTGGGGAATTAAACAAATAATTTCAAGTTCTACCTCCACCACCTACCAGCT
GCATGATCTTAGACCATTGACATCACCTCCCTGACCGTGATTTTCACATCTAGAGAATGG
GAGGGGAAGAACCATGCCTTGGGGGCCAGGCTGAGGATGAACTATGAAAACCCGTCCTAT
TGGGCACTCTCGAACAGTCACCATTGTTGGTATGAGGCCCACTATCAGTGAAACTGATTG
AAATTGGTGTACATCTGAGACCTGAGGACAGCCATCAAGTGTCTATTAACTTAAGCTTTA
TGTAGCAAGCATTTATTGCACATGATCCTAGGTCCCAAGTATGCTTCGGTAAATTAAACA
CCCTTGGTCCCTGCCCTCACAAGCCGTTCATAATCTAGACAGATACATAAGATATAAATG
CACAATTGTTCATTGAAAATCTCCGAAGTCACTGGCTATTTTCTGTGGTTCTCGGCACCA
TCACCACCCTTCCAAATTCTCTCCTGTTCTCAGGGGTTAGAAACCTGCAAACTACATTCC
CTAGACTTCCTTGCCTGTAGGAGCAAAATGATCCCATGTATTACTGCGAAATGGTAGTGT
CTGGGTCCCAGAAGACAGTTAGTAGAATCAGAATGTAGGAAAGTGTGTGCCACAGCCACA
CATGTTCATGATAGTCATAACTTGTTCAGTAGGAATTTAGAGAAGACTGACTGTACACAA
GGTATTGCTAAATGCTATGCGGGATACAGAGATGCCTGTGCCTCTAAGAAACTTGGTAGA
AAAATAATAACCCACACATATTTGGCTTACCTTCTCTTTGAATAGAGCAATTGGCAGTTT
AGATTCAGTCATTCTTCAATTCATTTAGCCAAAATTTATTCTGTGATGGCTGAATCCAAC
AAATGAAGTCTCTACTCTCATATTATTTTCCATTTTGTTCCACTGAATTTCAGCAAACAT
AGACCAGACAAGCATCCCTTTGAAACCTGGACTTGGGATGAGGGTCTGCTGAGATTGGGT
TTTCTCCATGCCCAGATGCCTCTGATCAAATATCAAGTCCCAAAGATACAGATGAGAAAG
TTATTAAGTGTTCTGGGATTGGGACATCGGAGATATTAATTAACCCTGGCTTGAGATGGG
AAGAGGGGGCAGGTAGCTTTCTTTGTGTAGTGTTTAGGAAGGTGATTGCCAATCTAGGAG
AAGTGAGTTCCCCAGAGGGAGGGGGGCTCTTGGCCAGCAGGGTGACCCATATGTTCTGGT
CTGCCTGGAGCTGTGGTCCTTGGGTTCACAGCGGCCCCTTTGCACTCAAAGCACCCTAGC
TTGGACAATAAATTCTACAGTCAGTTCTGCAGTGACGATCTTCAATTCCTAGGGCTGCCA
TAAGAGAAGATCATAGACTAGGGGTGGTACACGACAGAAATTCATCTTCTCCCAGTTCTG
GAGCCTGAAAATCCAAAACAAGGTGCTGTCAGGGTTGGATTCTCCTTGGGCCTCTCTTCT
TGGCTTGCAGGTGGCTGTCTTCTGGCTGTGTCCTCGTGTGTCCCCAACATCCCCCTGTGT
GTGTGTGCAACCCTTATGTCTCTTCCTCTGCTCATAAGAAAACAGTCCTATAGGACTAGG
ACCACATTCTTATGGCCTCATTTAACCTTAATTACCTCCTTTAGGGCCCTGTCTCCAAAT
ATGTTCAGTGGAGGTTTGGGGCTTTGGCATATGAGTCTTTGGAGGCCACAGTTCTGTCCA
GAACACACTGACCCTATCCACCAGGTACTGCCACACCAATGGCTTTCAGCATTAGACAGA
GCCCCCCTGGGCTCTGTAACCCCACCCAGGGTGTTAAGAATGAGGAGTGAAAGTCCACAC
ATGTACACACATGTTAATAGCAGCATTATGCGCAACAGTCAAACAGTGGACACACCCAAA
TGCCCATCAGTGGATGATGGATACATGCAAGGTGATTTATCCAGACAGTGGCATCATATT

more info here:
Piringer

1512 Feb 2013 Soundcloud

Leave a comment

What do you think? Sign up with Discord, Facebook, Google, Twitter to leave a comment.